pSCKbreak12
(Plasmid
#69938)
-
PurposepSTC2,cisRaj12-sfGFP, KanR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69938 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSTC2
- Backbone size w/o insert (bp) 33764655
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCisRaj12-sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)1278
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (unknown if destroyed)
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer gctcactcaaaggcggtaat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please check Genbank file for complete sequence annotation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCKbreak12 was a gift from Alfonso Jaramillo (Addgene plasmid # 69938 ; http://n2t.net/addgene:69938 ; RRID:Addgene_69938) -
For your References section:
Dynamic signal processing by ribozyme-mediated RNA circuits to control gene expression. Shen S, Rodrigo G, Prakash S, Majer E, Landrain TE, Kirov B, Daros JA, Jaramillo A. Nucleic Acids Res. 2015 May 26;43(10):5158-70. doi: 10.1093/nar/gkv287. Epub 2015 Apr 27. 10.1093/nar/gkv287 PubMed 25916845