pT7_circRAJ31_C873U
(Plasmid #69932)

• Purpose: Expresses RAJ31 riboregulator encased in a permuted intron exon ribozyme, which circularises the riboregulator. This mutant is deficient in circularisation. Under control of a T7 promoter.
• Depositing Lab: Alfonso Jaramillo
• Publication: Rostain et al Biodes Res. 2020 Sep 12;2020:1916789. doi: 10.34133/2020/1916789. eCollection 2020.

Backbone

• Vector backbone: pSB1C3
• Backbone manufacturer: Registry of Standard Biological Parts
• Backbone size w/o insert (bp): 451
• Total vector size (bp): 2491
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pT7_circRAJ31_C873U
• Species: Synthetic
• Insert Size (bp): 451
• Promoter: T7

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Resource Information

• Supplemental Documents:
  • pT7_circRAJ31_C873U in pSB1C3

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Engineering a circular riboregulator in Escherichia coli - Rostain et al.
Please check Genbank file for complete annotation.