cisRAJ31-GFP-LAA
(Plasmid #69928)

• Purpose: Expresses cisRAJ31-GFP-LAA, a cis-repressed mRNA regulated by RAJ31.
• Depositing Lab: Alfonso Jaramillo
• Publication: Rostain et al Biodes Res. 2020 Sep 12;2020:1916789. doi: 10.34133/2020/1916789. eCollection 2020.

Backbone

• Vector backbone: pSB4K5
• Backbone manufacturer: Registry of Standard Biological Parts
• Backbone size w/o insert (bp): 4296
• Total vector size (bp): 3424
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PllacO1-cisRAJ31-GFP-LAA
• Species: Synthetic
• Insert Size (bp): 872
• Promoter: PlLacO1

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Resource Information

• Supplemental Documents:
  • cisRAJ31-GFP-LAA in pSC101 vector

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Engineering a circular riboregulator in Escherichia coli - Rostain et al.
Please check Genbank file for complete annotation.