Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

cisRAJ31-GFP-LAA
(Plasmid #69928)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69928 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSB4K5
  • Backbone manufacturer
    Registry of Standard Biological Parts
  • Backbone size w/o insert (bp) 4296
  • Total vector size (bp) 3424
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PllacO1-cisRAJ31-GFP-LAA
  • Species
    Synthetic
  • Insert Size (bp)
    872
  • Promoter PlLacO1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Engineering a circular riboregulator in Escherichia coli - Rostain et al.
Please check Genbank file for complete annotation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cisRAJ31-GFP-LAA was a gift from Alfonso Jaramillo (Addgene plasmid # 69928 ; http://n2t.net/addgene:69928 ; RRID:Addgene_69928)
  • For your References section:

    Engineering a Circular Riboregulator in Escherichia coli. Rostain W, Shen S, Cordero T, Rodrigo G, Jaramillo A. Biodes Res. 2020 Sep 12;2020:1916789. doi: 10.34133/2020/1916789. eCollection 2020. 10.34133/2020/1916789 PubMed 37849901