pAAV.cTNT.iCre
(Plasmid #69916)

• Purpose: Used to package AAV9:cTNT.iCre, which specifically transduce cardiomyocytes and express Cre recombinase. Only works in vivo.
• Depositing Lab: William Pu
• Publication: Lin et al Circ Res. 2015 Jan 2;116(1):35-45. doi: 10.1161/CIRCRESAHA.115.304457. Epub 2014 Sep 23.

Backbone

• Vector backbone: AAV2/9.cTnT.PI.EGFP.RBG
• Backbone manufacturer: Penn Vector Core
• Backbone size w/o insert (bp): 4187
• Total vector size (bp): 7302
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: improved cre (iCre) recombinase and tdTomato
• Species: Synthetic
• Insert Size (bp): 3115
• Promoter: Chicken cardiac troponin T
• Tag / Fusion Protein:
  • The iCre coding frame and tdTomato coding frame is separated by IRES sequnece

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CCAATAGAAACTGGGCTTGTC
• 3′ sequencing primer: CCAGAAGTCAGATGCTCAAG

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The tdTomato sequence was cloned from the ROSAmT/mG construct. It has a membrane localization peptide. Because it is cloned downstream of IRES, the fluorescence signal is weak.