Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV.cTNT.iCre
(Plasmid #69916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69916 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV2/9.cTnT.PI.EGFP.RBG
  • Backbone manufacturer
    Penn Vector Core
  • Backbone size w/o insert (bp) 4187
  • Total vector size (bp) 7302
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    improved cre (iCre) recombinase and tdTomato
  • Species
    Synthetic
  • Insert Size (bp)
    3115
  • Promoter Chicken cardiac troponin T
  • Tag / Fusion Protein
    • The iCre coding frame and tdTomato coding frame is separated by IRES sequnece

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CCAATAGAAACTGGGCTTGTC
  • 3′ sequencing primer CCAGAAGTCAGATGCTCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The tdTomato sequence was cloned from the ROSAmT/mG construct. It has a membrane localization peptide. Because it is cloned downstream of IRES, the fluorescence signal is weak.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV.cTNT.iCre was a gift from William Pu (Addgene plasmid # 69916 ; http://n2t.net/addgene:69916 ; RRID:Addgene_69916)
  • For your References section:

    Pi3kcb links Hippo-YAP and PI3K-AKT signaling pathways to promote cardiomyocyte proliferation and survival. Lin Z, Zhou P, von Gise A, Gu F, Ma Q, Chen J, Guo H, van Gorp PR, Wang DZ, Pu WT. Circ Res. 2015 Jan 2;116(1):35-45. doi: 10.1161/CIRCRESAHA.115.304457. Epub 2014 Sep 23. 10.1161/CIRCRESAHA.115.304457 PubMed 25249570