pAAV:cTNT::Luciferase
(Plasmid #69915)

• Purpose: Used to package AAV9:cTNT::luciferase. Specifically transduce cardiomyocytes.
• Depositing Lab: William Pu
• Publication: Lin et al Circ Res. 2014 Jul 18;115(3):354-63. doi: 10.1161/CIRCRESAHA.115.303632. Epub 2014 May 15.

Backbone

• Vector backbone: AAV2/9.cTnT.PI.EGFP.RBG
• Backbone manufacturer: Penn Vector Core
• Backbone size w/o insert (bp): 4405
• Total vector size (bp): 6047
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Growth instructions: The plasmid will easily get mutated if bacterial cultured too long. Using SmaI to do a diagnose digestion is recommended.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly luciferase
• Species: Firefly
• Insert Size (bp): 1653
• GenBank ID: Nuleotide> U47295
• Promoter: Chicken cardiac troponin T

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CCAATAGAAACTGGGCTTGTC
• 3′ sequencing primer: CCAGAAGTCAGATGCTCAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The luciferase gene was PCR amplified from pGL basic vector (Promega) .
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains chicken cardiac tromonin T promoter. When packaged into AAV9 virus using the AAV 2/9 Rep/Cap plasmid, the AAV9:cTNT.Luciferease virus will easily transduce the neonatal mouse. This virus does not work in vitro cultured cardiomyocytes.