pcDNA3.1(+) ZKSCAN1 MCS-WT Split GFP + Sense IRES
(Plasmid #69909)

• Purpose: Expresses a GFP circular RNA containing the sense EMCV IRES in mammalian cells
• Depositing Lab: Jeremy Wilusz
• Publication: Kramer et al Genes Dev. 2015 Oct 8.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone manufacturer: Life Technologies
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 8012
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ZKSCAN1, GFP
• Species: H. sapiens (human)
• Entrez Gene: ZKSCAN1 (a.k.a. KOX18, PHZ-37, ZNF139, ZNF36, ZSCAN33)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry