pcDNA3.1(+) ZKSCAN1 MCS-HIPK3 Exon
(Plasmid #69905)

• Purpose: Expresses the human HIPK3 exon 2 circular RNA in mammalian cells
• Depositing Lab: Jeremy Wilusz
• Publication: Kramer et al Genes Dev. 2015 Oct 8.

Backbone

• Vector backbone: pcDNA3.1(+) ZKSCAN1 MCS Exon Vector
• Backbone size w/o insert (bp): 6705
• Total vector size (bp): 7765
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HIPK3
• Alt name: Homeodomain Interacting Protein Kinase 3
• Species: H. sapiens (human), D. melanogaster (fly)
• Insert Size (bp): 1099
• Mutation: Expresses aa1-194 of HIPK3
• Entrez Gene: HIPK3 (a.k.a. DYRK6, FIST3, PKY, YAK1)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry