-
PurposeExpression plasmid for expressing circular RNAs of a desired sequence in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6705
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZKSCAN1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1297
-
Entrez GeneZKSCAN1 (a.k.a. KOX18, PHZ-37, ZNF139, ZNF36, ZSCAN33)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+) ZKSCAN1 MCS Exon Vector was a gift from Jeremy Wilusz (Addgene plasmid # 69901) -
For your References section:
Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Kramer MC, Liang D, Tatomer DC, Gold B, March ZM, Cherry S, Wilusz JE. Genes Dev. 2015 Oct 8. 10.1101/gad.270421.115 PubMed 26450910