pcDNA3.1(+) Laccase2 MCS-ZKSCAN1 548-847
(Plasmid #69894)

• Purpose: Expresses a miniature version of the ZKSCAN1 circular RNA in mammalian cells
• Depositing Lab: Jeremy Wilusz
• Publication: Kramer et al Genes Dev. 2015 Oct 8.

Backbone

• Vector backbone: pcDNA3.1(+) Laccase2 MCS Exon Vector
• Backbone size w/o insert (bp): 6926
• Total vector size (bp): 7183
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ZKSCAN1
• Species: H. sapiens (human)
• Insert Size (bp): 300
• Entrez Gene: stw (a.k.a. Dmel_CG42345, CG10398, CG10408, CG30437, CG32838, CG42345, Dmel\CG42345, Dmel_CG30437, Dmel_CG32838, Laccase2, MCO2, laccase2, str)
• Entrez Gene: ZKSCAN1 (a.k.a. KOX18, PHZ-37, ZNF139, ZNF36, ZSCAN33)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry