Hy_pMT Laccase2 MCS-HIPK3 Exon
(Plasmid #69888)

• Purpose: Expresses the human HIPK3 exon 2 circular RNA in Drosophila
• Depositing Lab: Jeremy Wilusz
• Publication: Kramer et al Genes Dev. 2015 Oct 8.

Backbone

• Vector backbone: Hy_pMT Laccase2 MCS Exon Vector
• Backbone size w/o insert (bp): 8622
• Total vector size (bp): 9271
• Vector type: Insect Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HIPK3
• Alt name: Homeodomain Interacting Protein Kinase 3
• Species: H. sapiens (human), D. melanogaster (fly)
• Insert Size (bp): 1099
• Mutation: Expresses aa1-194 of HIPK3
• Entrez Gene: HIPK3 (a.k.a. DYRK6, FIST3, PKY, YAK1)
• Promoter: Metallothionein Promoter (pMT)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: CACTCGAATTTGGAGCCGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry