Skip to main content
Addgene

Hy_pMT Laccase2 MCS-ZKSCAN1 548-1047
(Plasmid #69886)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69886 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Hy_pMT Laccase2 MCS Exon Vector
  • Backbone size w/o insert (bp) 8622
  • Total vector size (bp) 9122
  • Vector type
    Insect Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ZKSCAN1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    500
  • Entrez Gene
    stw (a.k.a. Dmel_CG42345, CG10398, CG10408, CG30437, CG32838, CG42345, Dmel\CG42345, Dmel_CG30437, Dmel_CG32838, Laccase2, MCO2, laccase2, str)
  • Entrez Gene
    ZKSCAN1 (a.k.a. KOX18, PHZ-37, ZNF139, ZNF36, ZSCAN33)
  • Promoter Metallothionein Promoter (pMT)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CACTCGAATTTGGAGCCGGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there is an additional 84 amino acids that will be expressed on the C-terminus of the ZKSCAN1 (aa1-137) insert in this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hy_pMT Laccase2 MCS-ZKSCAN1 548-1047 was a gift from Jeremy Wilusz (Addgene plasmid # 69886 ; http://n2t.net/addgene:69886 ; RRID:Addgene_69886)

  • For your References section:

    Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Kramer MC, Liang D, Tatomer DC, Gold B, March ZM, Cherry S, Wilusz JE. Genes Dev. 2015 Oct 8. 10.1101/gad.270421.115 PubMed 26450910
Related items:
Commonly requested with: