Hy_pMT Laccase2 MCS Exon Vector
(Plasmid #69884)

• Purpose: Expression plasmid for expressing circular RNAs of a desired sequence in Drosophila
• Depositing Lab: Jeremy Wilusz
• Publication: Kramer et al Genes Dev. 2015 Oct 8.

Backbone

• Vector backbone: Hy_pMT
• Backbone size w/o insert (bp): 7143
• Total vector size (bp): 8655
• Vector type: Insect Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Laccase2
• Species: D. melanogaster (fly)
• Insert Size (bp): 1512
• Entrez Gene: stw (a.k.a. Dmel_CG42345, CG10398, CG10408, CG30437, CG32838, CG42345, Dmel\CG42345, Dmel_CG30437, Dmel_CG32838, Laccase2, MCO2, laccase2, str)
• Promoter: Metallothionein Promoter (pMT)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CACTCGAATTTGGAGCCGGC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry