Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTL370
(Plasmid #69880)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69880 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGE-attB-GMR
  • Backbone manufacturer
    Huang et al., 2009, PMID 19429710
  • Total vector size (bp) 16880
  • Vector type
    phiC31-integration vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CIRL
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    Cirl (a.k.a. Dmel_CG8639, BcDNA:GH07331, CG8639, CIRL, Dmel\CG8639, anon-WO0170980.7, anon-WO0170980.8, dcirl)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer pCasper-R GTCGGCAAGAGACATCCACT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTL370 was a gift from Robert Kittel & Tobias Langenhan (Addgene plasmid # 69880 ; http://n2t.net/addgene:69880 ; RRID:Addgene_69880)
  • For your References section:

    The adhesion GPCR latrophilin/CIRL shapes mechanosensation. Scholz N, Gehring J, Guan C, Ljaschenko D, Fischer R, Lakshmanan V, Kittel RJ, Langenhan T. Cell Rep. 2015 May 12;11(6):866-74. doi: 10.1016/j.celrep.2015.04.008. Epub 2015 Apr 30. 10.1016/j.celrep.2015.04.008 PubMed 25937282