pEGFP-C3-PLK4-S285A/T289A-3xFLAG
(Plasmid #69841)

• Purpose: This plasmid encodes PLK4 isoform 1 carrying S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tag
• Depositing Lab: Michel Bornens
• Publication: Sillibourne et al Mol Biol Cell. 2010 Feb 15;21(4):547-61. doi: 10.1091/mbc.E09-06-0505. Epub 2009 Dec 23.

Backbone

• Vector backbone: pEGFP-C3
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4794
• Total vector size (bp): 7704
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PLK4
• Species: H. sapiens (human)
• Insert Size (bp): 2910
• Mutation: S285A/T289A
• GenBank ID: NM_014264
• Entrez Gene: PLK4 (a.k.a. MCCRP2, SAK, STK18)
• Promoter: CMV
• Tags / Fusion Proteins:
  • EGFP (N terminal on insert)
  • 3xFLAG tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (not destroyed)
• 3′ cloning site: Hind III (not destroyed)
• 5′ sequencing primer: GFP 3' Fw (TTCGTGACCGCCGCCGGGATCA)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry