pLenti-CaMKIIa-SpyTag-C1C2-mCherry
(Plasmid #69833)

• Purpose: Lentiviral vector with CaMKIIa promoter and upstream CMV promoter expressing SpyTag-C1C2-mCherry fusion. SpyTag can be used to monitor membrane localization of the C1C2 opsin.
• Depositing Lab: Viviana Gradinaru
• Publication: Bedbrook et al Chem Biol. 2015 Aug 20;22(8):1108-21. doi: 10.1016/j.chembiol.2015.06.020. Epub 2015 Jul 23.

Backbone

• Vector backbone: pLenti-CamKIIa
• Backbone size w/o insert (bp): 9252
• Total vector size (bp): 11112
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpyTag-C1C2
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 1860
• Mutation: Inserted SpyTag after the signal peptide of C1C2.
• Promoter: CamKIIa
• Tags / Fusion Proteins:
  • Trafficking signal
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTGGATGCTGACGAAGGCTC
• 3′ sequencing primer: AAAGCAGCGTATCCACATAGC

Resource Information

• Supplemental Documents:
  • GeneBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry