Skip to main content
Addgene

pcDNA 3.2/V5-DEST RBM14-V5
(Plasmid #69823)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69823 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA 3.2/V5-DEST
  • Backbone size w/o insert (bp) 5396
  • Total vector size (bp) 7505
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RNA-binding protein 14
  • Alt name
    RBM14, PSP2, SIP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2109
  • GenBank ID
    BC000488
  • Entrez Gene
    RBM14 (a.k.a. COAA, PSP2, SIP, SYTIP1, TMEM137)
  • Promoter cmv
  • Tag / Fusion Protein
    • v5 (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGCACCAAAATCAACGGGACTTTC
  • 3′ sequencing primer GTCTCCTTCCGTGTTTCAGTTAGCC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

vector is Gateway and cDNA is from Orfeome library (Open Biosystems)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA 3.2/V5-DEST RBM14-V5 was a gift from Anne Brunet (Addgene plasmid # 69823 ; http://n2t.net/addgene:69823 ; RRID:Addgene_69823)

  • For your References section:

    Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Schaffer BE, Levin RS, Hertz NT, Maures TJ, Schoof ML, Hollstein PE, Benayoun BA, Banko MR, Shaw RJ, Shokat KM, Brunet A. Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8. 10.1016/j.cmet.2015.09.009 PubMed 26456332
Related items:
Commonly requested with: