pECE M2-SH3PXD2A WT
(Plasmid #69813)

• Purpose: Expresses M2-SH3PXD2A in mammalian cells
• Depositing Lab: Anne Brunet
• Publication: Schaffer et al Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8.

Backbone

• Vector backbone: pECE
• Backbone size w/o insert (bp): 2898
• Total vector size (bp): 6249
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SH3 and PX domain-containing protein 2A
• Alt name: SH3PXD2A, FISH, TKS5
• Species: H. sapiens (human)
• Entrez Gene: SH3PXD2A (a.k.a. FISH, SH3MD1, TKS5)
• Promoter: SV40 early promoter
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 in backbone, Mfe1 in TKS5 pcr product (destroyed during cloning)
• 3′ cloning site: Xba1 (not destroyed)
• 5′ sequencing primer: CATTCTCCGCCCCATGGCTGAC
• 3′ sequencing primer: GTTTCAGGTTCAGGGGGAGGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cDNA is from GeneCopoeia
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry