Skip to main content
Addgene

pECE M2-SNX17 WT
(Plasmid #69811)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69811 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pECE
  • Backbone size w/o insert (bp) 2898
  • Total vector size (bp) 4344
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sorting nexin-17
  • Alt name
    SNX17
  • Species
    H. sapiens (human)
  • Entrez Gene
    SNX17
  • Promoter SV40 early promoter
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer CATTCTCCGCCCCATGGCTGAC
  • 3′ sequencing primer GTTTCAGGTTCAGGGGGAGGTG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA is from the Orfeome library (Open Biosystems)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECE M2-SNX17 WT was a gift from Anne Brunet (Addgene plasmid # 69811 ; http://n2t.net/addgene:69811 ; RRID:Addgene_69811)

  • For your References section:

    Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Schaffer BE, Levin RS, Hertz NT, Maures TJ, Schoof ML, Hollstein PE, Benayoun BA, Banko MR, Shaw RJ, Shokat KM, Brunet A. Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8. 10.1016/j.cmet.2015.09.009 PubMed 26456332
Related items:
Commonly requested with: