pSFFV-Cx45
(Plasmid
#69808)
-
Purposemammalian expression of chick Cx45
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSFFV
-
Backbone manufacturerFuhlbrigge, et al 1998, PMID 3261013
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCx45
-
Alt nameGJC1
-
Alt nameConnexin45
-
SpeciesG. gallus (chicken)
-
Entrez GeneGJC1 (a.k.a. GJA7, GJD3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer SFFV-F attgattgactgcccacctc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was provided by Joseph Stains (University of Maryland School of Medicine), who received it from Thomas Steinberg (Washington University).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSFFV-Cx45 was a gift from Richard Veenstra (Addgene plasmid # 69808 ; http://n2t.net/addgene:69808 ; RRID:Addgene_69808) -
For your References section:
Multiple connexins confer distinct regulatory and conductance properties of gap junctions in developing heart. Veenstra RD, Wang HZ, Westphale EM, Beyer EC. Circ Res. 1992 Nov;71(5):1277-83. PubMed 1382884