xlox dNGFR-TERT
(Plasmid #69805)

• Purpose: MLV retroviral vector expressing the hTERT reverse transcriptase immortalizing gene and a tNGFR marker for tracking
• Depositing Lab: David Ott
• Publication: Andersen et al AIDS Res Hum Retroviruses. 2007 Mar;23(3):456-65.

Backbone

• Vector backbone: xlox dNGFR
• Backbone manufacturer: in lab construct
• Backbone size w/o insert (bp): 6588
• Total vector size (bp): 9987
• Vector type: Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hTERT reverse transcriptase
• Species: H. sapiens (human)
• Insert Size (bp): 3399
• Entrez Gene: TERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
• Promoter: MLV promoter
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTCGATCCTCCCTTTATCCA
• 3′ sequencing primer: GCATGCTCCAGACTGCCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Modified here from a full-length cDNA clone (IMAGE: 5263715) Life Technologies, Carlsbad, CA.
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry