pX330-mitf
(Plasmid #69801)

• Purpose: Used to make mitf knockout porcine cell line
• Depositing Lab: Jianguo Zhao
• Publication: Wang et al Sci Rep. 2015 Aug 21;5:13348. doi: 10.1038/srep13348.

Backbone

• Vector backbone: px330 (Addgene 42230)
• Backbone size w/o insert (bp): 8506
• Total vector size (bp): 8526
• Modifications to backbone: The R1 sgRNA genome targeting sequence was cloned into the pX330 vector
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mitf-sgRNA
• Species: Porcine
• Insert Size (bp): 20
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: CAAGGCTGTTAGAGAGATAATTGGA

Gene/Insert 2

• Gene/Insert name: SpCas9
• Species: Synthetic
• Insert Size (bp): 4101
• Promoter: Chicken Beta-Actin

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: pCBhProF (5' agggatggttggttggtggg 3')

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

the pX330 vector, created by the laboratory of Dr. Feng Zhang and obtained from Addgene (Plasmid 42230), was used. The R1 sgRNA genome targeting sequence was cloned into the pX330 vector.