pEGFP N1 Ub-CRT
(Plasmid
#69619)
-
PurposeExpress cytoplasmic mature CRT.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP N1
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6160
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUbiquitina-Calreticulin (mature)
-
Alt nameUb-CRT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1428
-
MutationDeletion of signal peptide of calreticulin at the N-terminus (17aa)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Ubiquitin (N terminal on insert)
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CGGGGTACCCCCAGCTCGTCCTTGGCCTGGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP N1 Ub-CRT was a gift from Marta Hallak (Addgene plasmid # 69619 ; http://n2t.net/addgene:69619 ; RRID:Addgene_69619) -
For your References section:
Calreticulin and Arginylated Calreticulin Have Different Susceptibilities to Proteasomal Degradation. Goitea VE, Hallak ME. J Biol Chem. 2015 Jun 26;290(26):16403-14. doi: 10.1074/jbc.M114.626127. Epub 2015 May 12. 10.1074/jbc.M114.626127 PubMed 25969538