pBS-L1PA1CH blast
(Plasmid
#69612)
-
PurposeExpresses a blasticidin tagged codon optimized L1PA1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 3530
- Total vector size (bp) 10811
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin ; detects retrotransposition not the plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAny standard E.coli strain should work fine
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL1PA1
-
Alt nameLINE-1 PA1 subfamily
-
Alt nameL1HS
-
Alt nameL1RP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7658
- Promoter CMV
-
Tag
/ Fusion Protein
- blast cassette
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGGCGTGTACGGTGGGAGGTCTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS-L1PA1CH blast was a gift from Astrid Roy-Engel (Addgene plasmid # 69612 ; http://n2t.net/addgene:69612 ; RRID:Addgene_69612)