pBS-L1PA8WTmneo
(Plasmid #69609)

• Purpose: Expresses a neomycin tagged wildtype L1PA8
• Depositing Lab: Astrid Roy-Engel
• Publication: Wagstaff et al Mol Biol Evol. 2013 Jan;30(1):88-99. doi: 10.1093/molbev/mss202. Epub 2012 Aug 23.

Backbone

• Vector backbone: pBluescript
• Backbone size w/o insert (bp): 3530
• Total vector size (bp): 11568
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418) ; G418 detects retrotransposition not the plasmid

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Any standard E. coli strain should work fine.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: L1PA8
• Alt name: LINE-1 PA8 subfamily (wild type sequence)
• Species: H. sapiens (human)
• Insert Size (bp): 8027
• Promoter: CMV
• Tag / Fusion Protein:
  • mneo retrotransposition cassette

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AGGCGTGTACGGTGGGAGGTCTA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The ORF1 and ORF2 of the L1PA8 element were commercially synthetically generated and then cloned into the parental pBS-L1PA1CHmneo by swapping the two ORFs