p5E-Runx1+23
(Plasmid #69602)

• Purpose: Runx1 +23 kb intronic enhancer from mouse and beta-globin minimal promoter in a 5' entry vector for gateway cloning
• Depositing Labs: Owen Tamplin, Leonard Zon
• Publication: Tamplin et al Cell. 2015 Jan 15;160(1-2):241-52. doi: 10.1016/j.cell.2014.12.032.

Backbone

• Vector backbone: pENTR attL4-R1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4777
• Total vector size (bp): 3415
• Vector type: 5' Gateway Entry Vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Runx1 +23 intronic enhancer
• Species: M. musculus (mouse)
• Insert Size (bp): 548
• Entrez Gene: Runx1 (a.k.a. AML1, CBF-alpha-2, Cbfa2, Pebp2a2, Pebpa2b)
• Promoter: C57/BL6 mouse Runx1 +23 intronic enhancer

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BglII (destroyed during cloning)
• 5′ sequencing primer: GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC
• 3′ sequencing primer: GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC

Gene/Insert 2

• Gene/Insert name: Mouse beta-globin minimal promoter
• Alt name: Proximal promoter of Mus musculus hemoglobin, beta adult minor chain
• Alt name: Hbb-bt proximal promoter
• Species: M. musculus (mouse)
• Insert Size (bp): 131
• GenBank ID: NM_008220.5
• Promoter: C57/BL6 mouse beta-globin minimal promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: GGACTAGTCCAATCTGCTCAGAGAGGACA
• 3′ sequencing primer: GGCCGCGGGATGTCTGTTTCTGAGGTTGC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

All PCR was performed using the High Fidelity Advantage 2 PCR Kit (Clontech). The Runx1 +23 enhancer (1) was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (XhoI and BamHI sites added) 5’-GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC-3’ and Reverse (BglII and NotI sites added) 5’- GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC -3’. The PCR fragment was gel purified, XhoI/BglII digested, ligated into XhoI/BamHI digested Tol2kit (2) #228 p5E-MCS vector and sequence verified. The mouse beta-globin minimal promoter was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (SpeI site added) 5’-GGACTAGTCCAATCTGCTCAGAGAGGACA-3’ and Reverse (SacII site added) 5’-GGCCGCGGGATGTCTGTTTCTGAGGTTGC-3’. The beta-globin minimal promoter and Runx1+23 5’ entry vector were SpeI/SacII digested and ligated together. Multisite Gateway reactions were performed according to the Invitrogen protocol.

1. Nottingham, W. T., Jarratt, A., Burgess, M., Speck, C. L., Cheng, J.-F., Prabhakar, S., et al. (2007). Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer. Blood, 110(13), 4188–4197. http://doi.org/10.1182/blood-2007-07-100883

2. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., et al. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics : an Official Publication of the American Association of Anatomists, 236(11), 3088–3099. http://doi.org/10.1002/dvdy.21343