p3A9cbetaTCR.HSV2.3
(Plasmid
#69594)
-
PurposeTCR beta chain genomic transgenic construct for generation of gBT-I mice
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonep3A9CbetaTCR
-
Backbone manufacturerCarbone Lab, Addgene plasmid 69600
- Total vector size (bp) 13590
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCR beta VJ region from clone HSV2.3
-
Alt nameT cell receptor beta chain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1000
-
Entrez GeneTcrb (a.k.a. TCRbeta, Tib)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer AATCGATGGCCACTGGTGTGCTT
- 3′ sequencing primer ATCGATTCTTCCTCAAGGAGGAACCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ApaI/NotI removes transgenic construct
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3A9cbetaTCR.HSV2.3 was a gift from Francis R. Carbone (Addgene plasmid # 69594 ; http://n2t.net/addgene:69594 ; RRID:Addgene_69594) -
For your References section:
Characterization of two TCR transgenic mouse lines specific for herpes simplex virus. Mueller SN, Heath W, McLain JD, Carbone FR, Jones CM. Immunol Cell Biol. 2002 Apr;80(2):156-63. 10.1046/j.1440-1711.2002.01071.x PubMed 11940116
Map uploaded by the depositor.
