pES.HSV2.3a
(Plasmid
#69593)
-
PurposeTCR a chain construct for generation of gBT-I mice
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepES4
-
Backbone manufacturerKaye, et al. J. Immunol. 1992; 148: 3342-53.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCR alpha chain cDNA from clone HSV2.3
-
Alt nameT cell receptor alpha chain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)800
-
Entrez GeneTcra (a.k.a. Tcralpha)
- Promoter H-2Kb
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BglII (destroyed during cloning)
- 5′ sequencing primer pES4-Fwd GGATCCAGGAATGGACAAGATTCTG
- 3′ sequencing primer pES4-Rev CAGATCTCAACTGGACCACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ClaI/NotI fragment used to make transgenic mice
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pES.HSV2.3a was a gift from Francis R. Carbone (Addgene plasmid # 69593 ; http://n2t.net/addgene:69593 ; RRID:Addgene_69593) -
For your References section:
Characterization of two TCR transgenic mouse lines specific for herpes simplex virus. Mueller SN, Heath W, McLain JD, Carbone FR, Jones CM. Immunol Cell Biol. 2002 Apr;80(2):156-63. 10.1046/j.1440-1711.2002.01071.x PubMed 11940116
Map uploaded by the depositor.
