Skip to main content
Addgene

pES.HSV2.3a
(Plasmid #69593)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69593 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pES4
  • Backbone manufacturer
    Kaye, et al. J. Immunol. 1992; 148: 3342-53.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TCR alpha chain cDNA from clone HSV2.3
  • Alt name
    T cell receptor alpha chain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    800
  • Entrez Gene
    Tcra (a.k.a. Tcralpha)
  • Promoter H-2Kb

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer pES4-Fwd GGATCCAGGAATGGACAAGATTCTG
  • 3′ sequencing primer pES4-Rev CAGATCTCAACTGGACCACAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ClaI/NotI fragment used to make transgenic mice

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pES.HSV2.3a was a gift from Francis R. Carbone (Addgene plasmid # 69593 ; http://n2t.net/addgene:69593 ; RRID:Addgene_69593)
  • For your References section:

    Characterization of two TCR transgenic mouse lines specific for herpes simplex virus. Mueller SN, Heath W, McLain JD, Carbone FR, Jones CM. Immunol Cell Biol. 2002 Apr;80(2):156-63. 10.1046/j.1440-1711.2002.01071.x PubMed 11940116