p3A9cbetaTCR.20beta
(Plasmid
#69592)
-
PurposeTCR beta chain genomic transgenic construct for creating OT-II mice
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep3A9CbetaTCR
-
Backbone manufacturerCarbone Lab, Addgene plasmid 69600
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCR beta VJ region from clone 1.1
-
Alt nameT cell receptor beta chain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)500
-
Entrez GeneTcrb (a.k.a. TCRbeta, Tib)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer GATCGATGCTGCTGCACAGACCTACT
- 3′ sequencing primer GATCGATCAGCTCACCTAACACGAGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3A9cbetaTCR.20beta was a gift from Francis R. Carbone (Addgene plasmid # 69592 ; http://n2t.net/addgene:69592 ; RRID:Addgene_69592) -
For your References section:
Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Barnden MJ, Allison J, Heath WR, Carbone FR. Immunol Cell Biol. 1998 Feb;76(1):34-40. 10.1046/j.1440-1711.1998.00709.x PubMed 9553774
Map uploaded by the depositor.
