Skip to main content
Addgene

pES4/4a
(Plasmid #69590)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69590 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pES4
  • Backbone manufacturer
    Kaye, et al. J. Immunol. 1992; 148: 3342-53.
  • Total vector size (bp) 8600
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TCR alpha
  • Alt name
    T cell receptor alpha chain
  • Alt name
    TCR alpha chain cDNA from Clone 1.1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    800
  • Entrez Gene
    Tcra (a.k.a. Tcralpha)
  • Promoter H-2Kb

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer pES4-Fwd GGATCCAGGAATGGACAAGATTCTG
  • 3′ sequencing primer pES4-Rev CAGATCTCAACTGGACCACAG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pES4/4a was a gift from Francis R. Carbone (Addgene plasmid # 69590 ; http://n2t.net/addgene:69590 ; RRID:Addgene_69590)

  • For your References section:

    Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Barnden MJ, Allison J, Heath WR, Carbone FR. Immunol Cell Biol. 1998 Feb;76(1):34-40. 10.1046/j.1440-1711.1998.00709.x PubMed 9553774
Related items:
Commonly requested with: