pRRLHygro-pEF1a-p53ashL344P-mKate2-splitmVenusC
(Plasmid #69587)

• Purpose: Expresses mutated p53-L344P tagged with mKate2 and split C-term mVenus
• Depositing Lab: Galit Lahav
• Publication: Gaglia et al Mol Syst Biol. 2014 Oct 24;10:753. doi: 10.15252/msb.20145168.

Backbone

• Vector backbone: pRRL
• Backbone size w/o insert (bp): 7765
• Total vector size (bp): 11150
• Modifications to backbone: hygromycin resistance
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: p53-L344P
• Species: H. sapiens (human)
• Insert Size (bp): 1179
• Mutation: p53 L344P mutation that prevents dimerization and tetramerization and 7 silent mutations in p53 DNA to prevent targeting by shRNA at positions C777T, T778A, C779G, A781T, G782C, T786A, T789C
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
• Promoter: EF1alpha
• Tags / Fusion Proteins:
  • mKate2 (C terminal on insert)
  • split mVenus - C term (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CAAGTTTGTACAAAAAAGCAGGCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The silent mutations prevent targeting by shRNA p53 published in Brummelkamp et al Science. 2002;296:550–3. This is tagged with the C-terminus of a split mVenus. The L344P mutation prevents tetramerization and dimerization of p53.