pRRLNeo-pEF1a-p53ashL344A-mKate2-splitmVenusN
(Plasmid #69584)

• Purpose: Expresses mutated p53-L344A tagged with mKate2 and split N-term mVenus
• Depositing Lab: Galit Lahav
• Publication: Gaglia et al Mol Syst Biol. 2014 Oct 24;10:753. doi: 10.15252/msb.20145168.

Backbone

• Vector backbone: pRRL
• Backbone size w/o insert (bp): 7429
• Total vector size (bp): 11046
• Modifications to backbone: neomycin resistance
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: p53-L344A
• Species: H. sapiens (human)
• Insert Size (bp): 1179
• Mutation: p53 L344A mutation that prevents tetramerization and 7 silent mutations in p53 DNA to prevent targeting by shRNA at positions C777T, T778A, C779G, A781T, G782C, T786A, T789C
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
• Promoter: EF1alpha
• Tags / Fusion Proteins:
  • mKate2 (C terminal on insert)
  • split mVenus - N term (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CAAGTTTGTACAAAAAAGCAGGCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This mutant will dimerize, but not tetramerize. This p53 is tagged with the N-term of a split mVenus. The silent mutations prevent targeting by shRNA p53 published in Brummelkamp et al Science. 2002;296:550–3.