pRRLNeo-pEF1a-p53ashL344A-mCerulean
(Plasmid
#69580)
-
PurposeExpresses p53-L344A mutant tagged with mCerulean
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 7429
- Total vector size (bp) 10565
-
Modifications to backboneneomycin resistance
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namep53-L344A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1179
-
Mutationp53 L344A mutation that prevents tetramerization and 7 silent mutations in p53 DNA to prevent targeting by shRNA at positions C777T, T778A, C779G, A781T, G782C, T786A, T789C
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter EF1alpha
-
Tag
/ Fusion Protein
- mCerulean (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAAGTTTGTACAAAAAAGCAGGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This mutant will dimerize, but not tetramerize. The silent mutations prevent targeting by shRNA p53 published in Brummelkamp et al Science. 2002;296:550–3.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRLNeo-pEF1a-p53ashL344A-mCerulean was a gift from Galit Lahav (Addgene plasmid # 69580 ; http://n2t.net/addgene:69580 ; RRID:Addgene_69580) -
For your References section:
Activation and control of p53 tetramerization in individual living cells. Gaglia G, Guan Y, Shah JV, Lahav G. Proc Natl Acad Sci U S A. 2013 Sep 17;110(38):15497-501. doi: 10.1073/pnas.1311126110. Epub 2013 Sep 4. 10.1073/pnas.1311126110 PubMed 24006363