pES.42.1c
(Plasmid
#69576)
-
PurposeTCR a chain cDNA in pES4 (transgenic construct) for creating OT-1 mice
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69576 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepES4
- Backbone size w/o insert (bp) 7800
- Total vector size (bp) 8640
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCR alpha clone 149.42
-
Alt nameT cell receptor alpha chain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)830
-
Entrez GeneTcra (a.k.a. Tcralpha)
- Promoter H-2Kb
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BglII (destroyed during cloning)
- 5′ sequencing primer pES4-Fwd GGATCCAGGAATGGACAAGATTCTG
- 3′ sequencing primer pES4-Rev CAGATCTCAACTGGACCACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pES.42.1c was a gift from Francis R. Carbone (Addgene plasmid # 69576 ; http://n2t.net/addgene:69576 ; RRID:Addgene_69576) -
For your References section:
T cell receptor antagonist peptides induce positive selection. Hogquist KA, Jameson SC, Heath WR, Howard JL, Bevan MJ, Carbone FR. Cell. 1994 Jan 14;76(1):17-27. 0092-8674(94)90169-4 [pii] PubMed 8287475
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/69/69576/69576-map_xRFw8llPwO0S.png.940x940_q85_autocrop.png)