pES.42.1c
(Plasmid #69576)

• Purpose: TCR a chain cDNA in pES4 (transgenic construct) for creating OT-1 mice
• Depositing Lab: Francis R. Carbone
• Publication: Hogquist et al Cell. 1994 Jan 14;76(1):17-27.

Backbone

• Vector backbone: pES4
• Backbone size w/o insert (bp): 7800
• Total vector size (bp): 8640
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TCR alpha clone 149.42
• Alt name: T cell receptor alpha chain
• Species: M. musculus (mouse)
• Insert Size (bp): 830
• Entrez Gene: Tcra (a.k.a. Tcralpha)
• Promoter: H-2Kb

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BglII (destroyed during cloning)
• 5′ sequencing primer: pES4-Fwd GGATCCAGGAATGGACAAGATTCTG
• 3′ sequencing primer: pES4-Rev CAGATCTCAACTGGACCACAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry