pCAG-N-CretrcintG
(Plasmid #69572)

• Purpose: One half component of the optimized Cre recombinase dependent on GFP (CRE-DOG OPT) for expression in mammalian cells
• Depositing Lab: Connie Cepko
• Publication: Tang et al Nat Neurosci. 2015 Sep;18(9):1334-41. doi: 10.1038/nn.4081. Epub 2015 Aug 10.

Backbone

• Vector backbone: pCAG-GFP
• Backbone size w/o insert (bp): 4823
• Total vector size (bp): 5579
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: kozak consensus - N-CretrcintG
• Species: Synthetic
• Insert Size (bp): 756
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGACTTCCTTTGTCCCAAATCTG
• 3′ sequencing primer: TAGCCAGAAGTCAGATGCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GBP7 obtained from Heinrich Leonardt and Ulrich Rothbauer at Ludwig Maximilians University Munich

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry