Myog'-2A-mCherryNLS-PGK-Puro
(Plasmid #69548)

• Purpose: Donor vector for homologous recombination to insert a 2A-mCherry-NLS cassette in place of the stop codon of myogenin in the mouse genome.
• Depositing Lab: Charles Gersbach
• Publication: TMG reporters (unpublished)

Backbone

• Vector backbone: PCR2.1
• Backbone manufacturer: Invitrogen
• Total vector size (bp): 7948
• Vector type: Mouse Targeting
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: 2A-mCherry-NLS
• Alt name: mCherry
• Species: Synthetic
• Insert Size (bp): 819
• Tags / Fusion Proteins:
  • PVT1-2A "skipping" peptide (N terminal on insert)
  • 2x nuclear localization signal (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: cttccctgctggtctctgac
• 3′ sequencing primer: CACCATCGTGGAACAGTACG

Gene/Insert 2

• Gene/Insert name: Myogenin 5' homology arm
• Species: M. musculus (mouse)
• Insert Size (bp): 702
• Mutation: Silent V205V mutation in myogenin gene to prevent Cas9-generated double-strand break.
• GenBank ID: NC_000067.6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: M13-Rev
• 3′ sequencing primer: AAGCGCATGAACTCCTTGAT

Gene/Insert 3

• Gene/Insert name: Myogenin 3' homology arm
• Alt name: Myog
• Species: M. musculus (mouse)
• Insert Size (bp): 675
• GenBank ID: NC_000067.6
• Entrez Gene: Myog (a.k.a. MYF4, bHLHc3, myo)

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: taggtccctcgaagaggttcacta
• 3′ sequencing primer: caaggcgattaagttgggtaacgccag

Resource Information

• Supplemental Documents:
  • MyogDonor-2A-mCherryNLS-PGK-Puro

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry