Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

tetO-MyoD-T2A-GFPnls-mPGK-rtTA-IRES-Puro
(Plasmid #69546)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69546 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRL
  • Total vector size (bp) 11004
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    eGFP
  • Alt name
    Enhanced green fluorescent protein
  • Species
    Synthetic
  • Tags / Fusion Proteins
    • 2x nuclear localization sequence (C terminal on insert)
    • T2A "skipping" peptide (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CCCAATGCGATTTATCAGGT
  • 3′ sequencing primer gacgtgaagaatgtgcgaga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Myod1
  • Alt name
    MyoD
  • Species
    M. musculus (mouse)
  • Mutation
    Removed stop codon to fuse it to the 2A-eGFPnls insert.
  • GenBank ID
    NM_010866.2
  • Entrez Gene
    Myod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer tacggtgggaggcctatataagca
  • 3′ sequencing primer GACCAGGATGGGCACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tetO-MyoD-T2A-GFPnls-mPGK-rtTA-IRES-Puro was a gift from Charles Gersbach (Addgene plasmid # 69546 ; http://n2t.net/addgene:69546 ; RRID:Addgene_69546)