tetO-MyoD-T2A-GFPnls-mPGK-rtTA-IRES-Puro
(Plasmid #69546)

• Purpose: Tet-On system expressing MyoD-2A-GFP-2xNLS.
• Depositing Lab: Charles Gersbach
• Publication: TMG reporters (unpublished)

Backbone

• Vector backbone: pRRL
• Total vector size (bp): 11004
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: eGFP
• Alt name: Enhanced green fluorescent protein
• Species: Synthetic
• Tags / Fusion Proteins:
  • 2x nuclear localization sequence (C terminal on insert)
  • T2A "skipping" peptide (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NsiI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CCCAATGCGATTTATCAGGT
• 3′ sequencing primer: gacgtgaagaatgtgcgaga

Gene/Insert 2

• Gene/Insert name: Myod1
• Alt name: MyoD
• Species: M. musculus (mouse)
• Mutation: Removed stop codon to fuse it to the 2A-eGFPnls insert.
• GenBank ID: NM_010866.2
• Entrez Gene: Myod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: tacggtgggaggcctatataagca
• 3′ sequencing primer: GACCAGGATGGGCACCAC

Resource Information

• Supplemental Documents:
  • tetO-MyoD-2A-GFPnls-PGK-rtTA-IRES-Puro

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry