pmtb-t7-alpha-bungarotoxin
(Plasmid #69542)

• Purpose: For in vitro transcription of alpha-bungarotoxin mRNA that can be injected into embryos.
• Depositing Lab: Sean Megason
• Publication: Swinburne et al PLoS One. 2015 Aug 5;10(8):e0134005. doi: 10.1371/journal.pone.0134005. eCollection 2015.

Backbone

• Vector backbone: pmtb
• Backbone size w/o insert (bp): 6353
• Total vector size (bp): 6641
• Vector type: Tol2, beta-actin promoter, sp6,t7 for zebrafish

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: alpha-bungarotoxin
• Alt name: btx
• Species: Synthetic
• Insert Size (bp): 288
• GenBank ID: KT279887
• Promoter: beta-actin, sp6, t7

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggtcacatgcttgctgaaacgcc
• 3′ sequencing primer: GGT TTG TCC AAA CTC ATC AAT GTA TC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: synthesized by GeneArt/ life technologies
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For in vitro transcription, linearize with EcoRV, XmaI, SmaI, PmeI, or SphI