pCXLE-dCas9VP192-T2A-EGFP
(Plasmid #69536)

• Purpose: Episomal plasmid encoding dCas9VP192
• Depositing Lab: Timo Otonkoski
• Publication: Balboa et al Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001.

Backbone

• Vector backbone: pCXLE
• Total vector size (bp): 15848
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9-dCas9VP192-EGFP
• Insert Size (bp): 6802
• Promoter: CAG
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: ClaI (unknown if destroyed)
• 5′ sequencing primer: pCAG-F GCAACGTGCTGGTTATTGTG

Resource Information

• Supplemental Documents:
  • GenBank file pCXLE-dCas9VP192-T2A-EGFP
• A portion of this plasmid was derived from a plasmid made by: dCas9 Mutated from pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Addgene Plasmid #42335; pCXLE backbone with shp53 used from Addgene Plasmid #27078.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry