CAG-DDdCas9VP192-T2A-EGFP-ires-puro
(Plasmid #69534)

• Purpose: DHFR destabilised domain (DD) fused to dCas9VP192 (S.pyogenes) on CAG expression vector. DDdCas9VP192 protein is stabilised by Trimethoprim.
• Depositing Lab: Timo Otonkoski
• Publication: Balboa et al Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001.

Backbone

• Vector backbone: PyCAG
• Total vector size (bp): 12561
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DD-dCas9VP192-T2A-EGFP
• Insert Size (bp): 6138
• Promoter: CAG
• Tags / Fusion Proteins:
  • DHFR Destabilised Domain (N terminal on insert)
  • C-term T2A-EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: pCAG-F GCAACGTGCTGGTTATTGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: dCas9 Mutated from pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Addgene Plasmid #42335; DHFR cloned from pBMN DHFR(DD)-YFP, Addgene Plasmid #29325
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry