pECE HA AMPKa1 WT
(Plasmid #69504)

• Purpose: Expresses AMPK alpha1 in mammalian cells
• Depositing Lab: Anne Brunet
• Publication: Schaffer et al Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8.

Backbone

• Vector backbone: pECE
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 4589
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 5'-AMP-activated protein kinase catalytic subunit alpha-1
• Alt name: PRKAA1
• Alt name: AMPK1
• Species: H. sapiens (human)
• GenBank ID: BC037303
• Entrez Gene: PRKAA1 (a.k.a. AMPK, AMPK alpha 1, AMPKa1)
• Promoter: SV40 early promoter
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CATTCTCCGCCCCATGGCTGAC
• 3′ sequencing primer: GTTTCAGGTTCAGGGGGAGGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cDNA is from the Orfeome library (Open Biosystems)
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry