Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMXs-Puro-CLEC16A-EMP2
(Plasmid #69468)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69468 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMXs-Puro
  • Backbone manufacturer
    cell biolabs
  • Backbone size w/o insert (bp) 5604
  • Total vector size (bp) 7171
  • Modifications to backbone
    Added a fusion gene and a HA tag
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    200mg/L
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CLEC16A-EMP2
  • Alt name
    CLEC16A
  • Alt name
    EMP2
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_015226 NM_001424
  • Entrez Gene
    CLEC16A (a.k.a. Gop-1, KIAA0350)
  • Entrez Gene
    EMP2 (a.k.a. XMP)
  • Tag / Fusion Protein
    • HA TAG (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAGAACCTCGCTGGAAAGGA
  • 3′ sequencing primer CGGGACTATGGTTGCTGACT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-Puro-CLEC16A-EMP2 was a gift from Axel Hillmer (Addgene plasmid # 69468 ; http://n2t.net/addgene:69468 ; RRID:Addgene_69468)
  • For your References section:

    Recurrent Fusion Genes in Gastric Cancer: CLDN18-ARHGAP26 Induces Loss of Epithelial Integrity. Yao F, Kausalya JP, Sia YY, Teo AS, Lee WH, Ong AG, Zhang Z, Tan JH, Li G, Bertrand D, Liu X, Poh HM, Guan P, Zhu F, Pathiraja TN, Ariyaratne PN, Rao J, Woo XY, Cai S, Mulawadi FH, Poh WT, Veeravalli L, Chan CS, Lim SS, Leong ST, Neo SC, Choi PS, Chew EG, Nagarajan N, Jacques PE, So JB, Ruan X, Yeoh KG, Tan P, Sung WK, Hunziker W, Ruan Y, Hillmer AM. Cell Rep. 2015 Jul 14;12(2):272-85. doi: 10.1016/j.celrep.2015.06.020. Epub 2015 Jul 2. 10.1016/j.celrep.2015.06.020 PubMed 26146084