Skip to main content
Addgene

pMXs-Puro-CLDN18-ARHGAP26
(Plasmid #69465)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69465 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMXs-Puro
  • Backbone manufacturer
    cell biolabs
  • Backbone size w/o insert (bp) 5604
  • Total vector size (bp) 7579
  • Modifications to backbone
    Added a fusion gene and a HA tag
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    200mg/L
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CLDN18-ARHGAP26
  • Alt name
    claudin 18
  • Alt name
    Rho GTPase activating protein 26
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1975
  • GenBank ID
    NM_001002026 NM_001135608
  • Entrez Gene
    ARHGAP26 (a.k.a. GRAF, GRAF1, OPHN1L, OPHN1L1)
  • Entrez Gene
    CLDN18 (a.k.a. SFTA5, SFTPJ)
  • Tag / Fusion Protein
    • HA TAG (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAGAACCTCGCTGGAAAGGA
  • 3′ sequencing primer CGGGACTATGGTTGCTGACT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-Puro-CLDN18-ARHGAP26 was a gift from Axel Hillmer (Addgene plasmid # 69465 ; http://n2t.net/addgene:69465 ; RRID:Addgene_69465)

  • For your References section:

    Recurrent Fusion Genes in Gastric Cancer: CLDN18-ARHGAP26 Induces Loss of Epithelial Integrity. Yao F, Kausalya JP, Sia YY, Teo AS, Lee WH, Ong AG, Zhang Z, Tan JH, Li G, Bertrand D, Liu X, Poh HM, Guan P, Zhu F, Pathiraja TN, Ariyaratne PN, Rao J, Woo XY, Cai S, Mulawadi FH, Poh WT, Veeravalli L, Chan CS, Lim SS, Leong ST, Neo SC, Choi PS, Chew EG, Nagarajan N, Jacques PE, So JB, Ruan X, Yeoh KG, Tan P, Sung WK, Hunziker W, Ruan Y, Hillmer AM. Cell Rep. 2015 Jul 14;12(2):272-85. doi: 10.1016/j.celrep.2015.06.020. Epub 2015 Jul 2. 10.1016/j.celrep.2015.06.020 PubMed 26146084
Related items:
Commonly requested with: