pJBL-RNAOUTA4
(Plasmid #69458)

• Purpose: RNA-OUT A4 variant - antisense (UTR sequence from Mutalik et al., Nat. Chem. Biol., 2012)
• Depositing Lab: Julius Lucks
• Publication: Watters et al Nucleic Acids Res. 2015 Sep 8. pii: gkv879.

Backbone

• Vector backbone: custom
• Backbone manufacturer: N/A
• Backbone size w/o insert (bp): 2100
• Total vector size (bp): 2250
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RNA-OUT A4
• Alt name: IS10 counter-transcript (mutated A4 variant)
• Species: Synthetic
• Insert Size (bp): 140
• Promoter: J23119

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: aaccattattatcatgacattaac

Resource Information

• Supplemental Documents:
  • RNA-OUT A4 .ape file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutated from sequence obtained from Arkin Lab (UC Berkeley)

**Contains ColE1 origin (not automatically annotated by Addgene)**