pJBL-RNAINS4
(Plasmid
#69456)
-
PurposeRNA-IN S4 variant 5' UTR sequence controlling expression of superfolder GFP (UTR sequence from Mutalik et al., Nat. Chem. Biol., 2012)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonecustom
-
Backbone manufacturerN/A
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 3100
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRNA-IN S4 + SFGFP
-
Alt nameIS10 (mutated S4 variant)
-
SpeciesSynthetic
-
Insert Size (bp)900
-
Mutationmutations for S4 variant (from wt)
- Promoter J23119
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aaatgtagcacctgaagtcagcccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutated from sequence obtained from Arkin Lab (UC Berkeley)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJBL-RNAINS4 was a gift from Julius Lucks (Addgene plasmid # 69456 ; http://n2t.net/addgene:69456 ; RRID:Addgene_69456) -
For your References section:
Simultaneous characterization of cellular RNA structure and function with in-cell SHAPE-Seq. Watters KE, Abbott TR, Lucks JB. Nucleic Acids Res. 2015 Sep 8. pii: gkv879. 10.1093/nar/gkv879 PubMed 26350218