Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSFFV-Cx43
(Plasmid #69442)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69442 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSFFV
  • Backbone manufacturer
    Fuhlbrigge, et al 1998, PMID 3261013
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cx43
  • Alt name
    Gja1
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Gja1 (a.k.a. Cx43, Cxnk1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer SFFV-F attgattgactgcccacctc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was provided by Joseph Stains (University of Maryland School of Medicine), who received it from Thomas Steinberg (Washington University).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSFFV-Cx43 was a gift from Richard Veenstra (Addgene plasmid # 69442 ; http://n2t.net/addgene:69442 ; RRID:Addgene_69442)
  • For your References section:

    Selectivity of connexin-specific gap junctions does not correlate with channel conductance. Veenstra RD, Wang HZ, Beblo DA, Chilton MG, Harris AL, Beyer EC, Brink PR. Circ Res. 1995 Dec;77(6):1156-65. PubMed 7586229