pRRLSIN.cPPTLuciferase.WPRE
(Plasmid #69251)

• Purpose: luciferase reporter in lentivirus backbone
• Depositing Lab: Stephen Tapscott
• Publication: Dux4 reporters (unpublished)

Backbone

• Vector backbone: pRRLSIN.cPPT.PGK/GFP.WPRE
• Backbone size w/o insert (bp): 7384
• Total vector size (bp): 7809
• Modifications to backbone: hPGK and GFP were removed by digestion with XhoI and SalI and then replaced with Luciferase
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Luciferase
• Species: P. pyralis
• Insert Size (bp): 1653
• GenBank ID: M15077.1
• Promoter: none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: atcgatcacgagactagcc
• 3′ sequencing primer: AAGGAAGGTCCGCTGGATTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is designed for insertion of investigator's promoter of interest to permit lentiviral transduction of the luciferase reporter.