Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBEN276
(Plasmid #69150)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69150 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGRG25
  • Backbone manufacturer
    Nancy Craig - Johns Hopkins University (Addgene Plasmid #16665)
  • Backbone size w/o insert (bp) 12500
  • Total vector size (bp) 19671
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    luxCDABE
  • Species
    Photorhabdus luminescens
  • Insert Size (bp)
    6200
  • GenBank ID
    AF403784
  • Promoter frr

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AATTGCCCGTCGTATTAAAG
  • 3′ sequencing primer GTAGCGTCGTAAGCTAATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEN276 was a gift from Pierre Germon (Addgene plasmid # 69150 ; http://n2t.net/addgene:69150 ; RRID:Addgene_69150)
  • For your References section:

    Development of stable reporter system cloning luxCDABE genes into chromosome of Salmonella enterica serotypes using Tn7 transposon. Howe K, Karsi A, Germon P, Wills RW, Lawrence ML, Bailey RH. BMC Microbiol. 2010 Jul 23;10:197. doi: 10.1186/1471-2180-10-197. 10.1186/1471-2180-10-197 PubMed 20653968