pT3-Neo-EF1a-GFP
(Plasmid #69134)

• Purpose: (Empty Backbone) Sleeping Beaquty (SB) vector encoding G418 resistance and GFP from two separate promoters
• Depositing Lab: Martin Bonamino
• Publication: Chicaybam et al Front Bioeng Biotechnol. 2017 Jan 23;4:99. doi: 10.3389/fbioe.2016.00099. eCollection 2016.

Backbone

• Vector backbone: pT3
• Backbone size (bp): 4222
• Vector type: Mammalian Expression ; Sleeping Beauty transposon
• Promoter: U3MSCV
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: ACTAACCAATCAGTTCGCTTCTC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The EF1a-GFP cassette was isolated from the plasmid pRRLsin.PPTs.EF1a.GFPpre (Bonamino et al., 2004) (provided by Dr. Didier Trono, EPFL, Switzerland) after digestion with ClaI/BstBI and inserted in pT3-Neo previously digested with ClaI.

EGFP has additional 10 amino acids on the c-terminus of EGFP (SGLRSRLASS). Depositor states that these amino acids do not affect plasmid function.