Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mLPx-shZMPSTE24
(Plasmid #69067)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69067 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MLPx
  • Backbone size w/o insert (bp) 6527
  • Total vector size (bp) 6629
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA against ZMPSTE24
  • Alt name
    shFACE1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    102
  • Entrez Gene
    ZMPSTE24 (a.k.a. FACE-1, FACE1, HGPS, PRO1, RSDM1, STE24, Ste24p)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sequence of the 5' end of the hairpin is GATCATGGATTCTGAAACATT. This difference does not affect the ability of the hairpin to knockdown ZMPSTE24 expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mLPx-shZMPSTE24 was a gift from Gerardo Ferbeyre (Addgene plasmid # 69067 ; http://n2t.net/addgene:69067 ; RRID:Addgene_69067)
  • For your References section:

    Mutant lamin A links prophase to a p53 independent senescence program. Moiseeva O, Lessard F, Acevedo-Aquino M, Vernier M, Tsantrizos YS, Ferbeyre G. Cell Cycle. 2015 Aug 3;14(15):2408-21. doi: 10.1080/15384101.2015.1053671. Epub 2015 Jun 1. 10.1080/15384101.2015.1053671 PubMed 26029982