-
PurposeDual Fluorescent Reporter for F-actin and Nuclei
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69058 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA 3.1 (+)
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7751
-
Modifications to backboneinsert of the cassette Lifeact-GFP_IRES_NLS-mCherry
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLifeAct-GFP_IRES_NLS-mCherry
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)720
- Promoter CMV
-
Tag
/ Fusion Protein
- Lifeact-GFP, NLS-mCherry
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGGCTCTCCTCAAGCGTATT
- 3′ sequencing primer TTCAAAGGAAAACCACGTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GFP sequence was cloned from the pEGFP-C1 plasmid The IRES sequence was cloned from the pIRES plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA_Lifeact-GFP_NLS-mCherry was a gift from Olivier Pertz (Addgene plasmid # 69058 ; http://n2t.net/addgene:69058 ; RRID:Addgene_69058)